Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pEYFP-N1-eKR2
(Plasmid #115337)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 115337 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 3994
  • Total vector size (bp) 5773
  • Modifications to backbone
    EGFP was replaced by construct with tag and targeting sequences between BamHI and XbaI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eKR2
  • Species
    Synthetic; Dokdonia eikasta, Chlamydomonas reinhardtii
  • Mutation
    none
  • Promoter CMV
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer pEGFP-N1_F (GAGGTCTATATAAGCAGAGC), CMV_F (GCAAATGGGCGGTAGGCGT)
  • 3′ sequencing primer pEGFP-C1_R (AACCATTATAAGCTGCAATAAAC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEYFP-N1-eKR2 was a gift from Peter Hegemann (Addgene plasmid # 115337 ; http://n2t.net/addgene:115337 ; RRID:Addgene_115337)
  • For your References section:

    Electrical properties, substrate specificity and optogenetic potential of the engineered light-driven sodium pump eKR2. Grimm C, Silapetere A, Vogt A, Bernal Sierra YA, Hegemann P. Sci Rep. 2018 Jun 18;8(1):9316. doi: 10.1038/s41598-018-27690-w. 10.1038/s41598-018-27690-w [pii] PubMed 29915394