1
Plasmid 11535: pLIC.B4.BSU37660
  • phosphotransacetylase

  • 969

  • B. subtilis

  • NP_391646 BSU37660

  • HisTag-MBP, TEV cleavable

  • N terminal on backbone

  • pLIC.B4
    (Search Vector Database)

  • Bacterial Expression

  • 7313

  • SmaI

  • Yes

  • SmaI

  • Yes

  • CGTCAGACTGTCGATGAAGCCC List of Sequencing Primers

  • GTTGCATCACCTTCACCCTCTCC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Sung-Hou Kim

  • MTA

Comments: 

Please note that the plasmid pLIC.B4.BSU37660 contains an Ampicillin resistance marker, and the BL21 bacterial strain contains a plasmid, pSJS1244, that confers spectinomycin resistance and allows for expression of genes with rare codons.

Addgene provides this plasmid in the DH5alpha bacterial strain. For expression, please use BL21(DE3).Star/pSJS1244

This plasmid has not been sequence verified. If you would like Addgene to sequence a portion of this plasmid before you request it, please contact us.

Article: Crystal structures of a phosphotransacetylase from Bacillus subtilis and its complex with acetyl phosphate. Xu et al (J Struct Funct Genomics. 2005 Nov 9. ():1-11. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11535" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with