Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA 3.3 hFZD4
(Plasmid #115908)


Item Catalog # Description Quantity Price (USD)
Plasmid 115908 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pcDNA3.3 TOPO TA
  • Backbone size w/o insert (bp) 5407
  • Total vector size (bp) 7026
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    FZD4 (a.k.a. CD344, EVR1, FEVR, FZD4S, Fz-4, Fz4, FzE4, GPCR, hFz4)
  • Promoter CMV

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTTCCGTGTTTCAGTTAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Image clone 5199771

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TOPFlash reporter assay can be inhibited by transfection of too much of this plasmid (see Lai et al., 2017 for detailed description of transfection conditions).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA 3.3 hFZD4 was a gift from Harald Junge (Addgene plasmid # 115908 ; ; RRID:Addgene_115908)
  • For your References section:

    TSPAN12 Is a Norrin Co-receptor that Amplifies Frizzled4 Ligand Selectivity and Signaling. Lai MB, Zhang C, Shi J, Johnson V, Khandan L, McVey J, Klymkowsky MW, Chen Z, Junge HJ. Cell Rep. 2017 Jun 27;19(13):2809-2822. doi: 10.1016/j.celrep.2017.06.004. 10.1016/j.celrep.2017.06.004 PubMed 28658627