Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

retro-gRNA-eGFP
(Plasmid #116926)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 116926 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSCV
  • Total vector size (bp) 7017
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ataagtgcagtagtcgccgt
  • 3′ sequencing primer GCTTTAAATTTGCGCATGCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Includes LacZ gene for blue/white selection.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    retro-gRNA-eGFP was a gift from Christophe Benoist & Diane Mathis (Addgene plasmid # 116926 ; http://n2t.net/addgene:116926 ; RRID:Addgene_116926)
  • For your References section:

    Identification and validation of a tumor-infiltrating Treg transcriptional signature conserved across species and tumor types. Magnuson AM, Kiner E, Ergun A, Park JS, Asinovski N, Ortiz-Lopez A, Kilcoyne A, Paoluzzi-Tomada E, Weissleder R, Mathis D, Benoist C. Proc Natl Acad Sci U S A. 2018 Nov 6;115(45):E10672-E10681. doi: 10.1073/pnas.1810580115. Epub 2018 Oct 22. 10.1073/pnas.1810580115 PubMed 30348759