Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTn7xKS-sfGFP
(Plasmid #117394)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117394 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18
  • Modifications to backbone
    A gene encoding the Lac repressor (lacIQ allele) and a lac-controlled synthetic operon containing three genes encoding the antibacterial toxins HokB, GhoT, and TisB were inserted into the backbone via blunt-ligation into a blunted NdeI restriction site.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Also carries a gentamicin selectable marker
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    997
  • Promoter Ptac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (destroyed during cloning)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer caaagggaatcaggggatct
  • 3′ sequencing primer gaggggtggaaatggagttt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTn7xKS-sfGFP was a gift from Karen Guillemin (Addgene plasmid # 117394 ; http://n2t.net/addgene:117394 ; RRID:Addgene_117394)
  • For your References section:

    Modernized Tools for Streamlined Genetic Manipulation and Comparative Study of Wild and Diverse Proteobacterial Lineages. Wiles TJ, Wall ES, Schlomann BH, Hay EA, Parthasarathy R, Guillemin K. MBio. 2018 Oct 9;9(5). pii: mBio.01877-18. doi: 10.1128/mBio.01877-18. 10.1128/mBio.01877-18 PubMed 30301859