pN_35S/CTP-fluoE
(Plasmid
#117992)
-
PurposeChloroplast-targeted expression of CURT_fluoE controlled by the CaMV 35S promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepN_35S
- Backbone size w/o insert (bp) 9204
- Total vector size (bp) 11130
-
Modifications to backbonepB2GW7 backbone modified to replace bialaphos (BASTA) resistance gene (bar) with a nourseothricin resistance gene
-
Vector typePlant Expression, Synthetic Biology ; Plant/bacteria binary vector
-
Selectable markersNourseothricin/streptothricin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCTP-CURT_fluoE
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1203
- Promoter Cauliflower mosaic virus 35S
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCGGATTCCATTGCCCAGCTAT
- 3′ sequencing primer ATATGCTCAACACATGAGCGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe mCitrine coding sequence was originally obtained from the pET mCitrine LIC cloning vector (a gift from Scott Gradia (Addgene plasmid # 29771)). The mApple coding sequence was originally obtained from the mApple-pBAD expression plasmid (a gift from Michael Davidson & Nathan Shaner & Roger Tsien, Addgene plasmid # 54536)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN_35S/CTP-fluoE was a gift from Mathias Pribil (Addgene plasmid # 117992 ; http://n2t.net/addgene:117992 ; RRID:Addgene_117992) -
For your References section:
Membrane-bound protein scaffolding in diverse hosts using thylakoid protein CURT1A. Behrendorff JBYH, Sandoval-Ibanez OA, Sharma A, Pribil M. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418. 10.1021/acssynbio.8b00418 PubMed 30884945