-
PurposeFlourescent reporter for NF-kB activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSIRV
- Backbone size w/o insert (bp) 4865
- Total vector size (bp) 5585
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter minimal promoter with NF-kB responsive element
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site none (unknown if destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer GAGGGTATATAATGGAAGCTCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIRV-NF-kB-eGFP was a gift from Peter Steinberger (Addgene plasmid # 118093 ; http://n2t.net/addgene:118093 ; RRID:Addgene_118093) -
For your References section:
A cellular platform for the evaluation of immune checkpoint molecules. Jutz S, Hennig A, Paster W, Asrak O, Dijanovic D, Kellner F, Pickl WF, Huppa JB, Leitner J, Steinberger P. Oncotarget. 2017 May 4;8(39):64892-64906. doi: 10.18632/oncotarget.17615. eCollection 2017 Sep 12. 17615 [pii] PubMed 29029399