Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open and shipping orders.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-DYRK2-2A-GFP
(Plasmid #118284)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118284 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-2A-GFP
  • Backbone size w/o insert (bp) 5418
  • Total vector size (bp) 7215
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
  • Alt name
    DYRK2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1797
  • GenBank ID
    BC085145.1 NM_001014390.2
  • Entrez Gene
    Dyrk2 (a.k.a. 1810038L18Rik)
  • Promoter CMV with beta global intron
  • Tags / Fusion Proteins
    • 2A peptide (C terminal on insert)
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site SalI to XhoI (destroyed during cloning)
  • 5′ sequencing primer tggttgggataaggctggat
  • 3′ sequencing primer GFP reverse
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-DYRK2-2A-GFP was a gift from Vance Lemmon (Addgene plasmid # 118284 ; http://n2t.net/addgene:118284 ; RRID:Addgene_118284)
  • For your References section:

    Dyrk kinases regulate phosphorylation of doublecortin, cytoskeletal organization, and neuronal morphology. Slepak TI, Salay LD, Lemmon VP, Bixby JL. Cytoskeleton (Hoboken). 2012 Jul;69(7):514-27. doi: 10.1002/cm.21021. Epub 2012 Mar 7. 10.1002/cm.21021 PubMed 22359282