1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 11868: C-Ag15
  • Agrn

  • Agrin

  • 417

  • M. musculus (mouse)

  • NM_021604

  • Agrn (Agrin)

  • myc

  • C terminal on backbone

  • His

  • C terminal on backbone

  • pTrcHis2
    (Search Vector Database)

  • Invitrogen

  • Bacterial Expression

  • 4406

  • BamHI

  • No

  • EcoRI

  • No

  • AGAGGTATATATTAATGTATCG List of Sequencing Primers

  • N/A

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Martin Smith

  • MTA

Comments: 

Hilgenberg, L. G., Su, H., Gu, H., O'Dowd D, K. & Smith, M. A. (2006) alpha3Na+/K+-ATPase Is a neuronal receptor for agrin. Cell 125, 359-69.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The COOH-terminal domain of agrin signals via a synaptic receptor in central nervous system neurons. Hoover et al (J Cell Biol. 2003 Jun 9. 161(5):923-32. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11868" in your Materials and Methods section.

Price: $65.00

This is commonly requested with
11866: C-Ag20(0)
11867: C-Ag20(8)