pFUGW-GtACR1_C102A-EYFP
(Plasmid
#119196)
-
PurposeStep-function mutant of Guillardia theta anion channelrhodopsin 1 (GtACR1) with dramatically prolonged open state
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 119196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUGW
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAnion channelrhodopsin GtACR1 step-function mutant C102A
-
SpeciesGuillardia theta
-
Insert Size (bp)885
-
Mutationchanged cysteine 102 to alanine
-
GenBank IDKP171708 KP171708
- Promoter Ubiquitin
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATGCGCTCGGGGTTGGCGAGTGTG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUGW-GtACR1_C102A-EYFP was a gift from John Spudich (Addgene plasmid # 119196 ; http://n2t.net/addgene:119196 ; RRID:Addgene_119196) -
For your References section:
Extending the Time Domain of Neuronal Silencing with Cryptophyte Anion Channelrhodopsins. Govorunova EG, Sineshchekov OA, Hemmati R, Janz R, Morelle O, Melkonian M, Wong GK, Spudich JL. eNeuro. 2018 Jul 10;5(3). pii: eN-MNT-0174-18. doi: 10.1523/ENEURO.0174-18.2018. eCollection 2018 May-Jun. eN-MNT-0174-18 [pii] PubMed 30027111