Plasmid 11932: GFP-Ub KO.G76V
  • Ubiquitin KO.G76V

  • Ubiquitin

  • ubiquitin

  • Ub

  • 245

  • H. sapiens (human)

  • GFP

  • N terminal on backbone

  • Conjugation deficient mutant. All 7 lysines of ubiquitin mutated to arginines. Glycine 76 mutated to valine.

  • EGFP-C1
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • 4731

  • HindIII

  • No

  • KpnI

  • No

  • EGFP-C (CATGGTCCTGCTGGAGTTCGTG) List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • Neomycin

  • View sequences (3)
  • Nico Dantuma

    Ancillary Agreement for Plasmids Containing FP Materials

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A dynamic ubiquitin equilibrium couples proteasomal activity to chromatin remodeling. Dantuma et al (J Cell Biol. 2006 Apr 10. 173(1):19-26. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11932" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only