GFP-Ub KO.G76V
(Plasmid #11932)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    EGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    Ubiquitin KO.G76V
  • Alt name
    Ubiquitin
  • Alt name
    ubiquitin
  • Alt name
    Ub
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    245
  • Mutation
    Conjugation deficient mutant. All 7 lysines of ubiquitin mutated to arginines. Glycine 76 mutated to valine.
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer EGFP-C (CATGGTCCTGCTGGAGTTCGTG)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Ub KO.G76V was a gift from Nico Dantuma (Addgene plasmid # 11932)
  • For your References section:

    A dynamic ubiquitin equilibrium couples proteasomal activity to chromatin remodeling. Dantuma NP, Groothuis TA, Salomons FA, Neefjes J. J Cell Biol. 2006 Apr 10. 173(1):19-26. 10.1083/jcb.200510071 PubMed 16606690