1
Plasmid 11953: pYES2-Ub-R-GFP
  • Ub-R-GFP

  • Ubiquitin

  • Ub

  • 998

  • Ubiquitin fused to N-terminus of GFP. Arginine at position 1 between Ub and GFP (see article 10802622). N-end rule degradation signal.

  • pYES2
    (Search Vector Database)

  • Invitrogen

  • Yeast Expression

  • 5830

  • EcoRI

  • No

  • NotI

  • No

  • GAL1 primer List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • URA3

  • View sequences (2)
  • Nico Dantuma

  • MTA

Comments: 

The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a arginine at position 1 (see article 10802622, Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.

The Ub-R-GFP insert was then excised with EcoRI and NotI and cloned into pYES2.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Inhibition of ubiquitin/proteasome-dependent proteolysis in Saccharomyces cerevisiae by a Gly-Ala repeat. Heessen et al (FEBS Lett. 2003 Dec 4. 555(2):397-404. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11953" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only