Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYES2-Ub-R-GFP
(Plasmid #11953)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 11953 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYES2
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5830
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ub-R-GFP
  • Alt name
    Ubiquitin
  • Alt name
    Ub
  • Insert Size (bp)
    998
  • Mutation
    Ubiquitin fused to N-terminus of GFP. Arginine at position 1 between Ub and GFP (see article 10802622). N-end rule degradation signal.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GAL1 primer
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a arginine at position 1 (see article 10802622, Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.

The Ub-R-GFP insert was then excised with EcoRI and NotI and cloned into pYES2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYES2-Ub-R-GFP was a gift from Nico Dantuma (Addgene plasmid # 11953 ; http://n2t.net/addgene:11953 ; RRID:Addgene_11953)
  • For your References section:

    Inhibition of ubiquitin/proteasome-dependent proteolysis in Saccharomyces cerevisiae by a Gly-Ala repeat. Heessen S, Dantuma NP, Tessarz P, Jellne M, Masucci MG. FEBS Lett. 2003 Dec 4. 555(2):397-404. 10.1016/S0014-5793(03)01296-1 PubMed 14644450