|
Plasmid
11953:
pYES2-Ub-R-GFP
|
Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result. Inhibition of ubiquitin/proteasome-dependent proteolysis in Saccharomyces cerevisiae by a Gly-Ala repeat. Heessen et al (FEBS Lett. 2003 Dec 4. 555(2):397-404. PubMed) Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 11953" in your Materials and Methods section. |
The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a arginine at position 1 (see article 10802622, Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.
The Ub-R-GFP insert was then excised with EcoRI and NotI and cloned into pYES2.