Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pYM70
(Plasmid #119922)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 119922 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18
  • Backbone size w/o insert (bp) 6299
  • Total vector size (bp) 7331
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CaHygB
  • Alt name
    hygromycin B resistance gene
  • Species
    Candida albicnas
  • Insert Size (bp)
    1032
  • Promoter TEF2
  • Tag / Fusion Protein
    • CaHygB (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CTCGAGATGAAAAAACCAGAATTGACTGC
  • 3′ sequencing primer GAGCTAAAGAATAAGGATCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Luiz Basso, Charlie Gast

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYM70 was a gift from Brian Wong (Addgene plasmid # 119922 ; http://n2t.net/addgene:119922 ; RRID:Addgene_119922)
  • For your References section:

    Transformation of Candida albicans with a synthetic hygromycin B resistance gene. Basso LR Jr, Bartiss A, Mao Y, Gast CE, Coelho PS, Snyder M, Wong B. Yeast. 2010 Dec;27(12):1039-48. doi: 10.1002/yea.1813. Epub 2010 Aug 24. 10.1002/yea.1813 PubMed 20737428