1
Plasmid 12053: pAG69 G6PD 3'UTR mut
  • G6PD 3'UTR mut

  • G6PD

  • glucose-6-phosphate dehydrogenase

  • 380

  • H. sapiens (human)

  • NM_000402

  • G6PD (G6PD1)

  • Mutations in microRNA recognition sites (seed matches): 44-49 and 112-117 and 380-385.

  • pIS2
    (Search Vector Database)

  • pIS2 derived from pRL-SV40 (Promega)

  • Mammalian Expression, Luciferase

  • 3700

  • SacI

  • No

  • XbaI

  • No

  • EBV rev primer (GTGGTTTGTCCAAACTCATC) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • David Bartel

  • MTA
    Luciferase Limited Use Label License

Comments: 

G6PD 3'UTR mutant in renilla luciferase reporter plasmid.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh et al (Science. 2005 Dec 16. 310(5755):1817-21. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12053" in your Materials and Methods section.