pLEX-uORF-HA-birA*-H-Ras(wildtype)-IRES-Puro
(Plasmid
#120559)
-
PurposeExpresses HA-birA*-H-Ras wildtype fusion protein in mammalian cells & for virus production
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120559 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLEX
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 10682
- Total vector size (bp) 12249
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHRAS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1617
- Promoter CMV
-
Tag
/ Fusion Protein
- HA-birA* (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACCAAAATCAACGGGACTT
- 3′ sequencing primer ATATAGACAAACGCACACCGGCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX-uORF-HA-birA*-H-Ras(wildtype)-IRES-Puro was a gift from Paul Khavari (Addgene plasmid # 120559 ; http://n2t.net/addgene:120559 ; RRID:Addgene_120559) -
For your References section:
The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2. Kovalski JR, Bhaduri A, Zehnder AM, Neela PH, Che Y, Wozniak GG, Khavari PA. Mol Cell. 2019 Jan 4. pii: S1097-2765(18)31031-1. doi: 10.1016/j.molcel.2018.12.001. 10.1016/j.molcel.2018.12.001 PubMed 30639242