Skip to main content
Holiday Schedule: Addgene will be closed November 25th & 26th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #120995)


Item Catalog # Description Quantity Price (USD)
Plasmid 120995 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Sigma 28
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAATAGGCGTATCACGAGGCA
  • 3′ sequencing primer TTACCGCCTTTGAGTGAGCTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    C84m was a gift from Richard Murray (Addgene plasmid # 120995 ; ; RRID:Addgene_120995)