pMB34
(Plasmid
#122245)
-
PurposeLentivirus delivery for stable expression of LbCas12a-VPR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLL3.3
- Backbone size w/o insert (bp) 7301
- Total vector size (bp) 12695
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemammalian codon-optimized Lachnospiraceae bacterium Cas12a fused to VPR activator
-
Alt nameLbCpf1
-
SpeciesSynthetic
-
Insert Size (bp)5422
- Promoter EFs
-
Tags
/ Fusion Proteins
- VPR activator (C terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggaaagtgatgtcgtgtactgg
- 3′ sequencing primer ATGCTCCAGACTGCCTT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLbCas12a was amplified from pY109 (lenti-LbCas12a, Addgene plasmid # 84740 )
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMB34 was a gift from Darjus Tschaharganeh (Addgene plasmid # 122245 ; http://n2t.net/addgene:122245 ; RRID:Addgene_122245) -
For your References section:
Multiplexed orthogonal genome editing and transcriptional activation by Cas12a. Breinig M, Schweitzer AY, Herianto AM, Revia S, Schaefer L, Wendler L, Cobos Galvez A, Tschaharganeh DF. Nat Methods. 2019 Jan;16(1):51-54. doi: 10.1038/s41592-018-0262-1. Epub 2018 Dec 17. 10.1038/s41592-018-0262-1 [pii] PubMed 30559432