pSKAP_AR
(Plasmid
#122720)
-
PurposepSKAP plasmid containing the unique DNA barcode "AR" to be used for allelic exchange on bacterial chromosomes and subsequent molecular identification.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSKAP
-
Backbone manufacturerShaw and Bourret
- Backbone size w/o insert (bp) 4703
- Total vector size (bp) 4728
-
Modifications to backboneAddition of AR barcode sequence. TGTCGTACTGAGGTGTAACACACT
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBarcode AR
-
Insert Size (bp)25
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSKAP_AR was a gift from Travis Bourret (Addgene plasmid # 122720 ; http://n2t.net/addgene:122720 ; RRID:Addgene_122720) -
For your References section:
Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella. Shaw JA, Bourret TJ. J Vis Exp. 2019 May 13;(147). doi: 10.3791/59630. 10.3791/59630 PubMed 31132072