Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAC10058_pLX-DEST-IRES-NpuDnaE(C)-Neo(195-267)
(Plasmid #122781)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122781 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLX302 (Addgene #25896)
  • Modifications to backbone
    Puromycin removed
  • Vector type
    Mammalian Expression, Lentiviral ; Gateway Destination
  • Selectable markers
    NpuDnaE(C)-Neo(195-267)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NpuDnaE(C)-Neo(195-267)
  • Species
    Synthetic

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCCTCGGTCTCGATTCTACG
  • 3′ sequencing primer agcagcgtatccacatagcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/452979v2 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC10058_pLX-DEST-IRES-NpuDnaE(C)-Neo(195-267) was a gift from Albert Cheng (Addgene plasmid # 122781)
  • For your References section:

    Split Selectable Markers. Jillette N, Du M, Cheng AW. bioRxiv 452979 10.1101/452979