Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #125048)


Item Catalog # Description Quantity Price (USD)
Plasmid 125048 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Dueber lab, UC Berkeley
  • Backbone size w/o insert (bp) 1667
  • Vector type
    Yeast Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    TDH3 promoter
  • Alt name
    GAPDH3/GAP3 promoter
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer tttgctggccttttgctc
  • 3′ sequencing primer catctggatttgttcagaacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Contains the appropriate YTK-compatible Golden Gate overhangs for a type 2 part

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKmK.P15 was a gift from John Morrissey (Addgene plasmid # 125048 ; ; RRID:Addgene_125048)
  • For your References section:

    Biological Parts for Kluyveromyces marxianus Synthetic Biology. Arun S. Rajkumar, Javier A. Varela, Hannes Juergens, Jean-Marc G. Dara2 and John P. Morrissey. Front. Bioeng. Biotechnol., 07 May 2019 10.3389/fbioe.2019.00097