pAAV-Ef1a-vCreDIO hChR2(H134R)-eYFP 2.0
(Plasmid
#126081)
-
PurposevCre-Dependent ChR2(H134R)-eYFP with the vLox sites in the reverse orientation
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126081 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5581
- Total vector size (bp) 7243
-
Modifications to backbonevLox sites in reverse orientation
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehChR2(H134R)-eYFP
-
Alt nameChannelrhodopsin fused to YFP
-
Insert Size (bp)1662
-
MutationH134R
- Promoter Ef1a
-
Tag
/ Fusion Protein
- eYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GTTAGGCCAGCTTGGCACTTG
- 3′ sequencing primer GAATACCAGTCAATCTTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-vCreDIO hChR2(H134R)-eYFP 2.0 was a gift from Karl Deisseroth (Addgene plasmid # 126081 ; http://n2t.net/addgene:126081 ; RRID:Addgene_126081)