pOSV811
(Plasmid
#126604)
-
Purpose(Empty Backbone) modular integrative vector for the assembly of DNA fragments and expression in Streptomyces species
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126604 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonenew backbone
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- 5′ sequencing primer ATTTCAGTGCAATTTATCTCTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOSV811 was a gift from Jean-Luc Pernodet (Addgene plasmid # 126604 ; http://n2t.net/addgene:126604 ; RRID:Addgene_126604) -
For your References section:
A set of modular and integrative vectors for synthetic biology in Streptomyces. Aubry C, Pernodet JL, Lautru S. Appl Environ Microbiol. 2019 Jun 7. pii: AEM.00485-19. doi: 10.1128/AEM.00485-19. 10.1128/AEM.00485-19 PubMed 31175189