Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #127399)


Item Catalog # Description Quantity Price (USD)
Plasmid 127399 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5370
  • Total vector size (bp) 6711
  • Modifications to backbone
    Addition of Kozak Sequence
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Maltose Binding Protein
  • Alt name
  • Insert Size (bp)
  • Mutation
    Amino acid mutations: K295 to Amber codon and W340A
  • Promoter CMV
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • CAAX (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind III (not destroyed)
  • 3′ cloning site Not I (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GACAGTGGGAGTGGCACCTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The amino acid sequence of MBP was based on the pMAL-c5x vector (New England Biolabs) and was codon optimized for mammalian cell expression.
  • Terms and Licenses

Depositor Comments

W340A was introduced to reduce the affinity of MBP for endogenous ligands.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-MBP1-K295TAG-W340A-CAAX.pcDNA3-k was a gift from Sharona Gordon (Addgene plasmid # 127399 ; ; RRID:Addgene_127399)
  • For your References section:

    Visualizing conformational dynamics of proteins in solution and at the cell membrane. Gordon SE, Munari M, Zagotta WN. Elife. 2018 Jun 20;7. pii: 37248. doi: 10.7554/eLife.37248. 37248 [pii] PubMed 29923827