Sender plasmid
(Plasmid #127677)

• Purpose: Encodes the synthase LuxI for the quorum-sensing molecule C6-HSL.
• Depositing Lab: Friedrich Simmel
• Publication: Schwarz-Schilling et al Integr Biol (Camb). 2016 Apr 18;8(4):564-70. doi: 10.1039/c5ib00301f. Epub 2016 Jan 18.

Backbone

• Vector backbone: pETDuet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 5986
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LuxI
• Species: V. fischeri
• Insert Size (bp): 643
• Promoter: pT7
• Tag / Fusion Protein:
  • LVA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GTGATGTCGGCGATATAGG
• 3′ sequencing primer: GTTAATTAAGCTGCGCTAGTAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The plasmids were first used in the publication of Weitz et al. J. Am. Chem. Soc., 2014, 136, 72–75.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The insert was cloned by A. Mückl.