Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #127698)


Item Catalog # Description Quantity Price (USD)
Plasmid 127698 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 13320
  • Total vector size (bp) 13412
  • Modifications to backbone
    insertion of mouse cGAS specific shRNA hairpin sequence between XhoI and Eco RI restriction sites
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    shcGAS Mmu
  • Alt name
    Mb21d1, E330016A19Rik
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • GenBank ID
  • Entrez Gene
    Cgas (a.k.a. E330016A19Rik, Mb21d1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site xhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cagaaggctcgagaaggtatattgctgttgctgttgacagtgagcg
  • 3′ sequencing primer ctaaagtagccccttgaattccgaggcagtaggca
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ shcGAS-Mmu was a gift from Sandra Demaria (Addgene plasmid # 127698)
  • For your References section:

    DNA exonuclease Trex1 regulates radiotherapy-induced tumour immunogenicity. Vanpouille-Box C, Alard A, Aryankalayil MJ, Sarfraz Y, Diamond JM, Schneider RJ, Inghirami G, Coleman CN, Formenti SC, Demaria S. Nat Commun. 2017 Jun 9;8:15618. doi: 10.1038/ncomms15618. 10.1038/ncomms15618 PubMed 28598415