pMH-HT_CtCHAD-H253A-R256A-R260A
(Plasmid
#127788)
-
PurposeExpresses a CtCHAD mutant protein in E. coli cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMH-HT
-
Backbone manufacturerMichael Hothorn
- Backbone size w/o insert (bp) 5311
- Total vector size (bp) 6262
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCtCHAD
-
Alt nameQ8KE09
-
SpeciesChlorobium tepidum
-
Insert Size (bp)951
-
MutationResidues 208-522 (CHAD domain), mutations in His253, Arg256 and Arg260 to Ala
-
Entrez GeneCT0884 (a.k.a. CT0884)
-
Tag
/ Fusion Protein
- 6xHis tag + TEV cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TGCGTCCGGCGTAGAGGATCGAGATCT
- 3′ sequencing primer CAGCTTCCTTTCGGGCTTTGTTAGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH-HT_CtCHAD-H253A-R256A-R260A was a gift from Michael Hothorn (Addgene plasmid # 127788 ; http://n2t.net/addgene:127788 ; RRID:Addgene_127788) -
For your References section:
Molecular characterization of CHAD domains as inorganic polyphosphate-binding modules. Lorenzo-Orts L, Hohmann U, Zhu J, Hothorn M. Life Sci Alliance. 2019 May 27;2(3). pii: 2/3/e201900385. doi: 10.26508/lsa.201900385. Print 2019 Jun. 10.26508/lsa.201900385 PubMed 31133615