pAC1748
(Plasmid
#127982)
-
PurposeAMA1 plasmid with Aspergillus optimized Cpf1, argB selection marker, and USER cassette (PacI/Nt.BbvCI)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAC573
- Backbone size w/o insert (bp) 10868
- Total vector size (bp) 16125
-
Vector typeBacterial Expression, CRISPR ; Fungal Expression
-
Selectable markersargB
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCpf1
-
Alt nameLb_Cpf1 ; Cas12a
-
SpeciesSynthetic; Lachnospiraceae bacterium
-
Insert Size (bp)3846
-
Mutationcodon optimized for Aspergillus nidulans
- Promoter Aspergillus nidulans tef1 promoter
-
Tag
/ Fusion Protein
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTTCTCTGCTCAGCACCTCTACG
- 3′ sequencing primer GCTTTACGGGAAGAGCTGAGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe cpf1 gene contained in the vector is custom made version that we bought from Thermo Fisher Scientific.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC1748 was a gift from Uffe Mortensen (Addgene plasmid # 127982 ; http://n2t.net/addgene:127982 ; RRID:Addgene_127982) -
For your References section:
Cpf1 enables fast and efficient genome editing in Aspergilli. Vanegas KG, Jarczynska ZD, Strucko T, Mortensen UH. Fungal Biol Biotechnol. 2019 May 1;6:6. doi: 10.1186/s40694-019-0069-6. eCollection 2019. 10.1186/s40694-019-0069-6 PubMed 31061713