Skip to main content

pGEX2T-GATA2
(Plasmid #1289)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 1289 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pGEX-2T
  • Backbone manufacturer
    Amersham Biosciences
  • Backbone size w/o insert (bp) 4900
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GATA3
  • Species
    M. musculus (mouse)
  • GenBank ID
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX2T-GATA2 was a gift from Gokhan Hotamisligil (Addgene plasmid # 1289)
  • For your References section:

    Function of GATA transcription factors in preadipocyte-adipocyte transition. Tong Q, Dalgin G, Xu H, Ting CN, Leiden JM, Hotamisligil GS. Science 2000 Oct 6;290(5489):134-8. 10.1126/science.290.5489.134 PubMed 11021798