Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAH-CTX1-rha
(Plasmid #129390)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129390 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    mini-CTX1
  • Backbone manufacturer
    Hoang TT
  • Backbone size w/o insert (bp) 5610
  • Total vector size (bp) 7656
  • Modifications to backbone
    Insertion of the rhamnose-inducible promoter system from Escherichia coli (derived from pSC201).
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rhamnose-inducible promoter
  • Species
    E. coli
  • Insert Size (bp)
    2088
  • Mutation
    N/A
  • GenBank ID
    CP037857.1
  • Promoter PrhaBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GTCAGCAATTTCGCCAGCAG
  • 3′ sequencing primer AAGTGGATCAGCAAGGACGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rhamnose-inducible promoter was originally found in E. coli. The system was cloned from a vector in the Cardona lab, known as pSC201.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAH-CTX1-rha was a gift from Silvia Cardona (Addgene plasmid # 129390 ; http://n2t.net/addgene:129390 ; RRID:Addgene_129390)
  • For your References section:

    A broad-host-range CRISPRi toolkit for silencing gene expression in Burkholderia. Hogan AM, Rahman ASMZ, Lightly TJ, Cardona ST. ACS Synth Biol. 2019 Sep 6. doi: 10.1021/acssynbio.9b00232. 10.1021/acssynbio.9b00232 PubMed 31491085