pSH-EFIRES-P-GFP(1-10)opti
(Plasmid
#129416)
-
PurposeExpressing codon-optimized GFP(1-10) fragment in human cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSH-EFIRES-P
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 8892
-
Vector typeMammalian Expression, CRISPR, TALEN, Unspecified ; Human safe harbor locus (A AVS1) site-specific integration
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecodon-optimized GFP(1-10)
-
SpeciesSynthetic
-
Insert Size (bp)669
- Promoter EF-1α
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer tctctccacaggtgtccact
- 3′ sequencing primer acaccggccttattccaagc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCodon-optimized GFP(1-10) synthesized by Genescript.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector was generated by Shiqian Li (Elina Ikonen Lab).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH-EFIRES-P-GFP(1-10)opti was a gift from Elina Ikonen (Addgene plasmid # 129416 ; http://n2t.net/addgene:129416 ; RRID:Addgene_129416) -
For your References section:
Seipin Facilitates Triglyceride Flow to Lipid Droplet and Counteracts Droplet Ripening via Endoplasmic Reticulum Contact. Salo VT, Li S, Vihinen H, Holtta-Vuori M, Szkalisity A, Horvath P, Belevich I, Peranen J, Thiele C, Somerharju P, Zhao H, Santinho A, Thiam AR, Jokitalo E, Ikonen E. Dev Cell. 2019 Jun 6. pii: S1534-5807(19)30388-0. doi: 10.1016/j.devcel.2019.05.016. 10.1016/j.devcel.2019.05.016 PubMed 31178403