Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pFB1_hMLH1
(Plasmid #129426)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129426 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFastBac 1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4776
  • Total vector size (bp) 6966
  • Modifications to backbone
    hMLH1 is inserted in MCS (5'- BamH 1 and 3'- Xho I) of pFastBac 1. 5' sequencing primer covers nucleotides from 161-124 of hMLH1, but antiparallel, 3' sequencing primer covers nucleotides from 2148-2175 of hMLH1. They are used to sequence junction of the insert. The plasmid is used to amplify and generate recombinant bacmid DNA. which will then be transfected into insect cells for virus generation and eventually protein (hMLH1) expression.
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Use DH10Bac for bacmid expression.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human MLH1
  • Alt name
    DNA mismatch repair protein homolog (MLH1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2271
  • GenBank ID
    U07343
  • Entrez Gene
    MLH1 (a.k.a. COCA2, FCC2, HNPCC, HNPCC2, hMLH1)
  • Promoter Polyhedrin promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH I (not destroyed)
  • 3′ cloning site Xho I (not destroyed)
  • 5′ sequencing primer ccctctttaacaatcacttgaatacttgtggattttgc
  • 3′ sequencing primer ggaacacattgtctataaagccttgcgc
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFB1_hMLH1 was a gift from Peggy Hsieh (Addgene plasmid # 129426 ; http://n2t.net/addgene:129426 ; RRID:Addgene_129426)
  • For your References section:

    In vitro studies of DNA mismatch repair proteins. Geng H, Du C, Chen S, Salerno V, Manfredi C, Hsieh P. Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15. 10.1016/j.ab.2011.02.017 PubMed 21329650