pFB1_hMLH1
(Plasmid
#129426)
-
PurposeExpression human MLH1 protein using baculovirus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 129426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFastBac 1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4776
- Total vector size (bp) 6966
-
Modifications to backbonehMLH1 is inserted in MCS (5'- BamH 1 and 3'- Xho I) of pFastBac 1. 5' sequencing primer covers nucleotides from 161-124 of hMLH1, but antiparallel, 3' sequencing primer covers nucleotides from 2148-2175 of hMLH1. They are used to sequence junction of the insert. The plasmid is used to amplify and generate recombinant bacmid DNA. which will then be transfected into insect cells for virus generation and eventually protein (hMLH1) expression.
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse DH10Bac for bacmid expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman MLH1
-
Alt nameDNA mismatch repair protein homolog (MLH1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2271
-
GenBank IDU07343
-
Entrez GeneMLH1 (a.k.a. COCA2, FCC2, HNPCC, HNPCC2, LYNCH2, MLH-1, MMRCS1, hMLH1)
- Promoter Polyhedrin promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer ccctctttaacaatcacttgaatacttgtggattttgc
- 3′ sequencing primer ggaacacattgtctataaagccttgcgc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFB1_hMLH1 was a gift from Peggy Hsieh (Addgene plasmid # 129426 ; http://n2t.net/addgene:129426 ; RRID:Addgene_129426) -
For your References section:
In vitro studies of DNA mismatch repair proteins. Geng H, Du C, Chen S, Salerno V, Manfredi C, Hsieh P. Anal Biochem. 2011 Jun 15;413(2):179-84. doi: 10.1016/j.ab.2011.02.017. Epub 2011 Feb 15. 10.1016/j.ab.2011.02.017 PubMed 21329650