Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

hAID-BE3 (pRZ352)
(Plasmid #131316)


Item Catalog # Description Quantity Price (USD)
Plasmid 131316 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    pSQT817 (Addgene #53373)
  • Backbone size w/o insert (bp) 4843
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    hAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
  • Species
    H. sapiens (human); Streptococcus pyogenes, Bacillus subtilis bacteriophage PBS1, SV40
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTGCTAACCATGTTCATGCC
  • 3′ sequencing primer CAGAGGGAAAAAGATCTCAGTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    based on Addgene #100803

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hAID-BE3 (pRZ352) was a gift from Keith Joung (Addgene plasmid # 131316 ; ; RRID:Addgene_131316)
  • For your References section:

    CRISPR DNA base editors with reduced RNA off-target and self-editing activities. Grunewald J, Zhou R, Iyer S, Lareau CA, Garcia SP, Aryee MJ, Joung JK. Nat Biotechnol. 2019 Sep 2. pii: 10.1038/s41587-019-0236-6. doi: 10.1038/s41587-019-0236-6. 10.1038/s41587-019-0236-6 PubMed 31477922