pLKO-M7-puro
(Plasmid
#131697)
-
Purposeexpresses MHV68 M7 promoter driving puromycin resistance
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO
- Total vector size (bp) 7034
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameM7-puro
-
SpeciesMHV68
-
Insert Size (bp)249
-
Entrez GeneGAMMAHV.M7 (a.k.a. MuHV4gp49)
- Promoter M7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGGCTTGGTAGGTTTAAGAA
- 3′ sequencing primer GGCTTGTACTCGGTCATGGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/585984v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-M7-puro was a gift from Britt Glaunsinger (Addgene plasmid # 131697 ; http://n2t.net/addgene:131697 ; RRID:Addgene_131697) -
For your References section:
Xrn1 activity broadly represses RNA polymerase II occupancy at mammalian but not viral promoters during herpesvirus infection. Hartenian EN, Glaunsinger BA. bioRxiv 585984 10.1101/585984