Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTol2-PcyA-IRES-HO1
(Plasmid #131787)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 131787 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pzTol2
  • Backbone manufacturer
    VectorBuilder
  • Backbone size w/o insert (bp) 2800
  • Total vector size (bp) 6554
  • Vector type
    Mammalian Expression, Synthetic Biology ; Zebrafish Tol2 transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PcyA and HO1
  • Species
    H. sapiens (human), Synthetic; Thermosynechococcus elongatus
  • Insert Size (bp)
    2238
  • Promoter hsp70
  • Tag / Fusion Protein
    • MTS (Mitochondrial Targeting Signal from subunit VIII of human cytochrome C oxidase) (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer attB1: GTTTGTACAAAAAAGCAGGC
  • 3′ sequencing primer IRES-F
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The insert sequences are provided by Dr. Wilfried Weber from the University of Freiberg.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

This vector is designed by Dr. Shuo-Ting Yen from Eisenhoffer lab and synthesized by VectorBuilder.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol2-PcyA-IRES-HO1 was a gift from George Eisenhoffer (Addgene plasmid # 131787 ; http://n2t.net/addgene:131787 ; RRID:Addgene_131787)
  • For your References section:

    CreLite: An Optogenetically Controlled Cre/loxP System Using Red Light. Yen ST, Trimmer KA, Aboul N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. bioRxiv 10.1101/823971