Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

fIM1264
(Plasmid #132571)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 132571 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZA2
  • Backbone size w/o insert (bp) 1954
  • Total vector size (bp) 3118
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pLlacO-oxyR-TermT1
  • Insert Size (bp)
    1164
  • Entrez Gene
    oxyR (a.k.a. b3961, ECK3953, momR, mor)
  • Promoter pLlacO

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAAGAAAGCCATCCAGTTT
  • 3′ sequencing primer TGGCATCTTCCAGGAAATCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fIM1264 was a gift from Timothy Lu (Addgene plasmid # 132571 ; http://n2t.net/addgene:132571 ; RRID:Addgene_132571)
  • For your References section:

    Gene networks that compensate for crosstalk with crosstalk. Muller IE, Rubens JR, Jun T, Graham D, Xavier R, Lu TK. Nat Commun. 2019 Sep 6;10(1):4028. doi: 10.1038/s41467-019-12021-y. 10.1038/s41467-019-12021-y PubMed 31492904