pIM23
(Plasmid
#132586)
-
PurposepZA4-oxySp-mCherry-TEVrs-LAA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepZA4
- Backbone size w/o insert (bp) 2055
- Total vector size (bp) 3100
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameoxySp-mCherry-TEVrs-LAA-TermT1
-
Insert Size (bp)1045
- Promoter oxySp
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCGAACAGGCTTATGTCCAC
- 3′ sequencing primer TGGCATCTTCCAGGAAATCT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameNone
- Promoter none
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer none
- 3′ sequencing primer none (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIM23 was a gift from Timothy Lu (Addgene plasmid # 132586 ; http://n2t.net/addgene:132586 ; RRID:Addgene_132586) -
For your References section:
Gene networks that compensate for crosstalk with crosstalk. Muller IE, Rubens JR, Jun T, Graham D, Xavier R, Lu TK. Nat Commun. 2019 Sep 6;10(1):4028. doi: 10.1038/s41467-019-12021-y. 10.1038/s41467-019-12021-y PubMed 31492904