pCLASP_Crz1(19A)_CLASP_RGS2membrane
(Plasmid
#133085)
-
PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 133085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYTK146
- Total vector size (bp) 11102
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCrz1*-CLASP
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)4059
- Promoter pADH1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ctggccgataattgcagacgAACGG
- 3′ sequencing primer gatctatcgatttcaattcaattcaat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCLASP_Crz1(19A)_CLASP_RGS2membrane was a gift from Hana El-Samad (Addgene plasmid # 133085 ; http://n2t.net/addgene:133085 ; RRID:Addgene_133085) -
For your References section:
Optogenetic Control Reveals Differential Promoter Interpretation of Transcription Factor Nuclear Translocation Dynamics. Chen SY, Osimiri LC, Chevalier M, Bugaj LJ, Nguyen TH, Greenstein RA, Ng AH, Stewart-Ornstein J, Neves LT, El-Samad H. Cell Syst. 2020 Sep 4. pii: S2405-4712(20)30293-3. doi: 10.1016/j.cels.2020.08.009. 10.1016/j.cels.2020.08.009 PubMed 32898473