Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCLASP_Crz1(19A)_CLASP_RGS2membrane
(Plasmid #133085)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 133085 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pYTK146
  • Total vector size (bp) 11102
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Crz1*-CLASP
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    4059
  • Promoter pADH1

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ctggccgataattgcagacgAACGG
  • 3′ sequencing primer gatctatcgatttcaattcaattcaat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCLASP_Crz1(19A)_CLASP_RGS2membrane was a gift from Hana El-Samad (Addgene plasmid # 133085 ; http://n2t.net/addgene:133085 ; RRID:Addgene_133085)
  • For your References section:

    Optogenetic Control Reveals Differential Promoter Interpretation of Transcription Factor Nuclear Translocation Dynamics. Chen SY, Osimiri LC, Chevalier M, Bugaj LJ, Nguyen TH, Greenstein RA, Ng AH, Stewart-Ornstein J, Neves LT, El-Samad H. Cell Syst. 2020 Sep 4. pii: S2405-4712(20)30293-3. doi: 10.1016/j.cels.2020.08.009. 10.1016/j.cels.2020.08.009 PubMed 32898473