Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #133757)


Item Catalog # Description Quantity Price (USD)
Plasmid 133757 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 8102
  • Total vector size (bp) 9353
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Changed aspartate 169 to glycine.
  • GenBank ID
  • Entrez Gene
    TARDBP (a.k.a. ALS10, TDP-43)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcgtgtacggtgggagg
  • 3′ sequencing primer gcatgctccagactgccttgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX-Puro-TDP-43-D169G was a gift from Shawn Ferguson (Addgene plasmid # 133757 ; ; RRID:Addgene_133757)
  • For your References section:

    Pleiotropic requirements for human TDP-43 in the regulation of cell and organelle homeostasis. Roczniak-Ferguson A, Ferguson SM. Life Sci Alliance. 2019 Sep 16;2(5). pii: 2/5/e201900358. doi: 10.26508/lsa.201900358. Print 2019 Oct. 10.26508/lsa.201900358 PubMed 31527135