3xFLAG-dCas9/pMSCVhyg
(Plasmid
#134323)
-
PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCVhyg
-
Backbone manufacturerTakara Bio
- Backbone size w/o insert (bp) 7133
- Total vector size (bp) 11345
-
Vector typeMammalian Expression, Retroviral, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG-dCas9
-
SpeciesSynthetic; Streptococcus pyogenes
-
Insert Size (bp)4212
-
Mutationhuman codon-optimized, D10A + H840A
- Promoter LTR
-
Tags
/ Fusion Proteins
- 3xFLAG tag (N terminal on insert)
- NLS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Bgl II (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Construction strategy of gRNA retroviral vectors
1. Cleave gBlock from a gRNA vector constructed using gRNA cloning vector (Addgene #41824) with appropriate restriction enzymes (eg. [Xho I + Hind III], EcoR I).
2. Insert the cleaved gBlock into pSIR-based self-inactivating retroviral vectors.
Vectors & Sites of insertion
pSIR-neo (Addgene #51128): eg. [Xho I + Hind III]
pSIR-GFP (Addgene #51134): eg. [Xho I + Hind III], EcoR I
pSIR-DsRed-Express2 (Addgene #51135): eg. [Xho I + Hind III], EcoR I
pSIR-hCD2 (Addgene #51143): eg. EcoR I
For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xFLAG-dCas9/pMSCVhyg was a gift from Hodaka Fujii (Addgene plasmid # 134323 ; http://n2t.net/addgene:134323 ; RRID:Addgene_134323) -
For your References section:
MSCV-based retroviral plasmids expressing 3xFLAG-Sp-dCas9 for enChIP analysis. Yuno M, Nagata S, Fujita T, Fujii H. Biol Methods Protoc. 2021 Jul 9;6(1):bpab013. doi: 10.1093/biomethods/bpab013. eCollection 2021. 10.1093/biomethods/bpab013 PubMed 34409168