pHCL149
(Plasmid
#134457)
-
PurposeCmR, Para-popZ-rbs-H3H4-msfGFPN-CTM. Replicative plasmid for the expression of bait. N-terminal GFP fusion.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepTB285
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePara-popZ-rbs-H3H4-msfGFPN-CTM.
-
SpeciesSynthetic
- Promoter Para
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site vector-XbaI, insert-NheI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GATTATTTGCACGGCGTCACAC
- 3′ sequencing primer gtccattcacatctccgtccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHCL149 was a gift from Thomas Bernhardt (Addgene plasmid # 134457 ; http://n2t.net/addgene:134457 ; RRID:Addgene_134457) -
For your References section:
A PopZ-Linked Apical Recruitment Assay for Studying Protein-Protein Interactions in the Bacterial Cell Envelope. Lim HC, Bernhardt TG. Mol Microbiol. 2019 Sep 24. doi: 10.1111/mmi.14391. 10.1111/mmi.14391 PubMed 31550057