Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RBM15B_3xRRM_pGEX
(Plasmid #135125)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135125 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-6P-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5081
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RBM15B
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    543
  • Entrez Gene
    RBM15B (a.k.a. HUMAGCGB, OTT3)
  • Promoter tac
  • Tag / Fusion Protein
    • GST-SBP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer 5GEX (GGGCTGGCAAGCCACGTTTGGTG)
  • 3′ sequencing primer 3GEX (CCGGGAGCTGCATGTGTCAGAGG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RBM15B_3xRRM_pGEX was a gift from Christopher Burge (Addgene plasmid # 135125 ; http://n2t.net/addgene:135125 ; RRID:Addgene_135125)
  • For your References section:

    Sequence, Structure, and Context Preferences of Human RNA Binding Proteins. Dominguez D, Freese P, Alexis MS, Su A, Hochman M, Palden T, Bazile C, Lambert NJ, Van Nostrand EL, Pratt GA, Yeo GW, Graveley BR, Burge CB. Mol Cell. 2018 Jun 7;70(5):854-867.e9. doi: 10.1016/j.molcel.2018.05.001. Epub 2018 Jun 7. 10.1016/j.molcel.2018.05.001 PubMed 29883606