Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSB1C3-pT7-sfGFP_RED20
(Plasmid #135173)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135173 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB1C3
  • Backbone size w/o insert (bp) 2000
  • Total vector size (bp) 2700
  • Modifications to backbone
    Added T7 promoter upstream of GOI
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sfGFP_RED20
  • Alt name
    sfGFP
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • Mutation
    Recoded ORF of sfGFP to only use one codon per amino acid
  • GenBank ID
    MN315260
  • Promoter taatacgactcactata

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCACCTGACGTCTAAGAAAC
  • 3′ sequencing primer GTATTACCGCCTTTGAGTGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB1C3-pT7-sfGFP_RED20 was a gift from Drew Endy (Addgene plasmid # 135173 ; http://n2t.net/addgene:135173 ; RRID:Addgene_135173)
  • For your References section:

    Fail-safe genetic codes designed to intrinsically contain engineered organisms. Calles J, Justice I, Brinkley D, Garcia A, Endy D. Nucleic Acids Res. 2019 Sep 12. pii: 5568210. doi: 10.1093/nar/gkz745. 10.1093/nar/gkz745 PubMed 31511890