pEM01
(Plasmid
#135414)
-
PurposeExpression of Hygromycin resistance from CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS406
- Backbone size w/o insert (bp) 4287
- Total vector size (bp) 6475
-
Modifications to backboneInsert including CMVpr driving hph (HygR) and ADH1 terminator
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCMVpr hph ADH1t
-
Alt nameCMV promoter HygR ADH1 terminator
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)2188
-
GenBank IDYP_007349547.1 854068
- Promoter CMVpr
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACTTTATGCTTCCGGCTCCTATGTT
- 3′ sequencing primer CTGCCGGTAGAGGTGTGGTCAATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCMVpr from pAB1T7 / hph from pRS306H / ADH1t from pNB780 /
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEM01 was a gift from Nicolas Buchler (Addgene plasmid # 135414 ; http://n2t.net/addgene:135414 ; RRID:Addgene_135414) -
For your References section:
Genetic transformation of Spizellomyces punctatus, a resource for studying chytrid biology and evolutionary cell biology. Medina EM, Robinson KA, Bellingham-Johnstun K, Ianiri G, Laplante C, Fritz-Laylin LK, Buchler NE. Elife. 2020 May 11;9. pii: 52741. doi: 10.7554/eLife.52741. 10.7554/eLife.52741 PubMed 32392127