pEM03
(Plasmid
#135417)
-
PurposeExpression of Hygromycin resistance from Spizellomyces Hsp70 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135417 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEM01
-
Backbone manufacturerEdgar Medina
- Backbone size w/o insert (bp) 5885
- Total vector size (bp) 6961
-
Modifications to backbonereplaced CMVpr by digestion with SacI-HF & PacI and SLIC cloning Hsp70pr
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpunHsp70pr
-
Alt nameSpizellomyces Hsp70pr
-
SpeciesSpizellomyces punctatus
-
Insert Size (bp)1070
- Promoter Hsp70pr
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACTTTATGCTTCCGGCTCCTATGTT
- 3′ sequencing primer CTGCCGGTAGAGGTGTGGTCAATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEM03 was a gift from Nicolas Buchler (Addgene plasmid # 135417 ; http://n2t.net/addgene:135417 ; RRID:Addgene_135417) -
For your References section:
Genetic transformation of Spizellomyces punctatus, a resource for studying chytrid biology and evolutionary cell biology. Medina EM, Robinson KA, Bellingham-Johnstun K, Ianiri G, Laplante C, Fritz-Laylin LK, Buchler NE. Elife. 2020 May 11;9. pii: 52741. doi: 10.7554/eLife.52741. 10.7554/eLife.52741 PubMed 32392127