Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST
(Plasmid #135565)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 135565 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV SYN1 iRFP-FLAG
  • Total vector size (bp) 6000
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    miR-30 rat SST
  • Alt name
    miRNA vs Firefly somatostatin
  • Species
    R. norvegicus (rat)
  • Promoter SYN1

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Nuc-EYFP
  • Alt name
    Yellow Fluorescent protein
  • Insert Size (bp)
    800
  • Promoter hSYN1
  • Tag / Fusion Protein
    • 3xNLS (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ATGAAAGCCATACGGGAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST was a gift from Christopher Richie (Addgene plasmid # 135565 ; http://n2t.net/addgene:135565 ; RRID:Addgene_135565)
  • For your References section:

    Abstinence-dependent dissociable central amygdala microcircuits control drug craving. Venniro M, Russell TI, Ramsey LA, Richie CT, Lesscher HMB, Giovanetti SM, Messing RO, Shaham Y. Proc Natl Acad Sci U S A. 2020 Apr 7;117(14):8126-8134. doi: 10.1073/pnas.2001615117. Epub 2020 Mar 23. 10.1073/pnas.2001615117 PubMed 32205443