pSico_U6-PLOD2 sgRNA4
(Plasmid
#136459)
-
PurposeExpression of gRNA against human PLOD2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136459 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSico
- Backbone size w/o insert (bp) 9580
- Total vector size (bp) 9600
-
Modifications to backbonemKate2-T2A-Bsd cassette included on backbone driven by CAGs promoter
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA against human PLOD2
-
gRNA/shRNA sequenceTGAGCAAACAGTCCAGACGT
-
SpeciesH. sapiens (human), Synthetic
-
Entrez GenePLOD2 (a.k.a. BRKS2, LH2, TLH)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer CCTCTGCTAACCATGTTCATGC
- 3′ sequencing primer GATCTACCACATTTGTAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSico_U6-PLOD2 sgRNA4 was a gift from Antonio Amelio (Addgene plasmid # 136459 ; http://n2t.net/addgene:136459 ; RRID:Addgene_136459) -
For your References section:
Lysyl hydroxylase 2-induced collagen cross-link switching promotes metastasis in head and neck squamous cell carcinomas. Sato K, Parag-Sharma K, Terajima M, Musicant AM, Murphy RM, Ramsey MR, Hibi H, Yamauchi M, Amelio AL. Neoplasia. 2021 Jun 6;23(6):594-606. doi: 10.1016/j.neo.2021.05.014. 10.1016/j.neo.2021.05.014 PubMed 34107376