Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-hU6-mU6-Cre2GO
(Plasmid #136907)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 136907 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Adapted from pLentiCRISPRv1
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BlasCyGO
  • gRNA/shRNA sequence
    GACGACGGTGAGCAAGGGCG
  • Species
    Synthetic
  • Mutation
    ATG>ACG
  • Promoter SFFV

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-hU6-mU6-Cre2GO was a gift from Lukas Dow (Addgene plasmid # 136907 ; http://n2t.net/addgene:136907 ; RRID:Addgene_136907)
  • For your References section:

    GO: a functional reporter system to identify and enrich base editing activity. Katti A, Foronda M, Zimmerman J, Diaz B, Zafra MP, Goswami S, Dow LE. Nucleic Acids Res. 2020 Feb 29. pii: 5766653. doi: 10.1093/nar/gkaa124. 10.1093/nar/gkaa124 PubMed 32112097