Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLVX neo PFKL-GFP, K272R
(Plasmid #138290)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138290 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLVX neo
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8140
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PFKL
  • Alt name
    ATP-dependent 6-phosphofructokinase, liver type
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2343
  • Mutation
    K272R
  • Entrez Gene
    PFKL (a.k.a. ATP-PFK, PFK-B, PFK-L)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer CMV forward: CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer IRES-R: CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Thermo Ultimate lite Orfeome library: IOH6888; pENTR(tm)221

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLVX neo PFKL-GFP, K272R was a gift from Gaudenz Danuser (Addgene plasmid # 138290 ; http://n2t.net/addgene:138290 ; RRID:Addgene_138290)
  • For your References section:

    Mechanical regulation of glycolysis via cytoskeleton architecture. Park JS, Burckhardt CJ, Lazcano R, Solis LM, Isogai T, Li L, Chen CS, Gao B, Minna JD, Bachoo R, DeBerardinis RJ, Danuser G. Nature. 2020 Feb 12. pii: 10.1038/s41586-020-1998-1. doi: 10.1038/s41586-020-1998-1. 10.1038/s41586-020-1998-1 PubMed 32051585