Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

VRQR-HF1 variant
(Plasmid #138563)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138563 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFUGW
  • Total vector size (bp) 12859
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VRQR-HF1
  • Alt name
    VRQR-HF1 variant
  • Species
    Synthetic
  • Insert Size (bp)
    4641
  • Mutation
    N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R
  • Promoter EFS
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • FLAG (C terminal on insert)
    • BSD (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer 5' - ggtcttgaaaggagtgggaattgg - 3'
  • 3′ sequencing primer 5' - CAGGTCGCTTGTCGCCTCC - 3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VRQR-HF1 variant was a gift from Hyongbum Kim (Addgene plasmid # 138563 ; http://n2t.net/addgene:138563 ; RRID:Addgene_138563)
  • For your References section:

    Prediction of the sequence-specific cleavage activity of Cas9 variants. Kim N, Kim HK, Lee S, Seo JH, Choi JW, Park J, Min S, Yoon S, Cho SR, Kim HH. Nat Biotechnol. 2020 Nov;38(11):1328-1336. doi: 10.1038/s41587-020-0537-9. Epub 2020 Jun 8. 10.1038/s41587-020-0537-9 PubMed 32514125