Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pME18s-Ix_NPYLR1b
(Plasmid #138748)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138748 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pME18s
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 8269
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Ixodes scapularis NPYLR1b
  • Species
    Ixodes scapularis
  • Insert Size (bp)
    1269
  • GenBank ID
    KC439541 KC439541
  • Entrez Gene
    LOC8025400 (a.k.a. NPYLR1B)
  • Promoter SRa

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TTCTTGCAGATGTCGGATCA
  • 3′ sequencing primer TTTCTCCATGTTGCAGTGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME18s-Ix_NPYLR1b was a gift from Leslie Vosshall (Addgene plasmid # 138748 ; http://n2t.net/addgene:138748 ; RRID:Addgene_138748)
  • For your References section:

    Functional and genetic characterization of neuropeptide Y-like receptors in Aedes aegypti. Liesch J, Bellani LL, Vosshall LB. PLoS Negl Trop Dis. 2013 Oct 10;7(10):e2486. doi: 10.1371/journal.pntd.0002486. eCollection 2013. 10.1371/journal.pntd.0002486 PubMed 24130914